Journal: Biology Open

Article Title: Wtip and Vangl2 are required for mitotic spindle orientation and cloaca morphogenesis

doi: 10.1242/bio.20121016

Figure Lengend Snippet: ( A,B,C ) Side view of embryos at 48 hpf under light microscopy. (B) 48 hpf wtip morphants form pronephric cysts, hydrocephaly, body curvature and pericardial edema. The red arrow marks the location of the cyst dilation (B). ( D,E ) Lateral view of cloaca at 48 hpf. The blue arrow marks the cloaca. (C) wtip mRNA can rescue pronephric cyst, body curvature, hydrocephalus, and pericardial edema caused by wtipMO . Histological transverse-sections of 48 hpf embryos are 4 µm JB-4 plastic sections stained with hematoxylin and eosin ( F – K ) at the level of the glomerulus (F,G; red arrow), anterior pronephros (H,I; blue arrow), and cloaca (J,K; blue arrow). Glomerular cysts (G), dilated anterior pronephros (I) and cloaca malformation (K) were observed in the 48 hpf wtip morphants. Control morpholino injected embryos ( conMO ), wtip morpholino injected embryos ( wtipMO ), glomerulus (gl), and notochord (nc). Scale bars are 200 μm in A–C, 500 μm in D,E, and 100 μm in F–K.

Article Snippet: The followings morpholinos were obtained from Gene Tools, LLC, Philomath, Oregon, USA: Translational blocking morpholino oligonucleotide (MO) that targeted against the 5′UTR of wtip ( wtipMO : GATCCTCGTCGTATTCATCCATGTC), or the 5′UTR of vangl2 ( vangl2MO : GTACTGCGACTCGTTATCCATGTCG) ( ): a MO that blocked splicing of wtip exon2 by targeting the exon 2/intron 2-3 boundary ( wtipMOex2 : TGTATTTGTAGAAACTCACCGCATG) and a randomized control MO ( conMO: CCTCTTACCTCAGTTACAATTTATA).

Techniques: Light Microscopy, Staining, Control, Injection

Journal: Biology Open

Article Title: Wtip and Vangl2 are required for mitotic spindle orientation and cloaca morphogenesis

doi: 10.1242/bio.20121016

Figure Lengend Snippet: ( A ) Predicted domain structure of zebrafish Wtip protein. The putative nuclear export sequence (NES), SH3 binding domains, three LIM domains and the PDZ binding domain (PDZ) are shown in boxes. Anti-sense morpholino to target the translational initiation site of wtip mRNA ( wtipMO ) was used for wtip knockdown and wtip exon2 specific MO (wtipMOex2) was used to target the exon2/intron2 junction. ( B ) To test the function of wtip in zebrafish, we targeted splice donor sites in wtip exon2 with MO. The extent to which steric blockade of mRNA splicing caused alterations in wtip mRNA processing was quantified by RT-PCR using flanking exon primers. Injection of wtipMOex2 at the one- to two-cell stage resulted in an in-frame deletion of exon 2 and resulted in the joining of exon3 to exon1, thus deleting most of the first LIM domain. ( C ) The efficacy of the injected wtipMOex2 was quantified at 48 hpf by RT-PCR. The upper panel shows the result of RT-PCR with primers in exons1 and 4 of wtip . The lower panel shows the result of RT-PCR with primers for gapdh , used to control RNA amounts. ( D ) Side view of 48 hpf wtipMOex2 morphants displaying pronephric cysts, hydrocephalus, body curvature and pericardial edema. ( E ) Lateral view of cloaca at 48 hpf shows cloaca malformation. Histological transverse-sections of 48 hpf wtipMOex2 morphant embryos are 4 µm JB-4 plastic sections stained with hematoxylin and eosin ( F , G ) at the level of the glomerulus cysts (F, black arrow), tubular cysts (F, asterisks) and cloaca (G, black arrow). Scale bars are 200 μm in D and 10 μm in E–G.

Article Snippet: The followings morpholinos were obtained from Gene Tools, LLC, Philomath, Oregon, USA: Translational blocking morpholino oligonucleotide (MO) that targeted against the 5′UTR of wtip ( wtipMO : GATCCTCGTCGTATTCATCCATGTC), or the 5′UTR of vangl2 ( vangl2MO : GTACTGCGACTCGTTATCCATGTCG) ( ): a MO that blocked splicing of wtip exon2 by targeting the exon 2/intron 2-3 boundary ( wtipMOex2 : TGTATTTGTAGAAACTCACCGCATG) and a randomized control MO ( conMO: CCTCTTACCTCAGTTACAATTTATA).

Techniques: Sequencing, Binding Assay, Knockdown, Reverse Transcription Polymerase Chain Reaction, Injection, Control, Staining